Welcome

July 26th, 2016

          WELCOME TO THE DRU TYPING WEB PAGE

          As of 26 July, 2016 the dru database contains 99 dru repeats
          and 525 dru types with from 1 to 23 repeats

         

          Click here to go to the search page.

 

 

 

 

BACKGROUND:

Variable-number tandem repeat (VNTR) sequences have found important use in the epidemiological typing of problem bacterial pathogens. In methicillin-resistant Staphylococcus aureus (MRSA), the direct-repeat unit (dru) VNTR region adjacent to IS431 in SCCmec has proved useful in the epidemiological analysis of highly uniform epidemic strains (e.g., EMRSA15 and -16) and in tracking the horizontal movement of SCCmec.  Efficient use of dru typing has been facilitated by a uniform system of nomenclature.  However, optimum use of this typing approach requires a convenient means where newly generated data can be cataloged and compared in an internationally shared database.

Publication of the typing approach and nomenclature can be found at:

Goering, R. V., D. Morrison, Z. Al-Doori, G. F. Edwards, and C. G. Gemmell. 2008. Usefulness of mec-associated direct repeat unit (dru) typing in the epidemiological analysis of highly clonal methicillin-resistant Staphylococcus aureus in Scotland. Clin.Microbiol.Infect. 14:964-969.

PCR conditions:

forward primer 5’ GTTAGCATATTACCTCTCCTTGC 3’
reverse primer 5’ GCCGATTGTGCTTGATGAG 3’

Initial denaturation step at 94°C for 2 min followed by 30 cycles of 94°C for 1 min, 52°C for 1 min, and 72°C for 1 min.

 

QUERYING THE DATABASE:

The search page of the dru-typing.org website allows investigators to enter user generated 40-bp repeat sequences which are then searched against the current database of dru repeats (dr) and identified, if known.  Specific combinations of repeats separated by dashes (e.g., 5a-2d-3b-4e) may also be queried against the database and, if recognized, the resulting dru type (dt) will be identified.

Click here to go to the search page.

 

ADDITION OF NEW ENTRIES TO THE DATABASE:

New dru repeat and/or dru type chromatograms can be submitted online for verification and inclusion into the database. Investigators with potentially new dru-repeats (dr) or dru-types (dt) should submit their trace files (.ab1) of both forward and reverse sequences by email to:  info “at” dru-typing.org. Upon verification, the new entries will be added to the existing database.

Questions regarding the submission of new dru-repeat or dru-type sequences or other questions, comments, or suggestions may be emailed to: info “at” dru-typing.org  You can click here to download text files containing the latest dru types and dru repeats.

 

AUTOMATED DRU TYPING:

Working with dru repeat sequences manually can be a challenge. This can be dramatically simplified for those laboratories having access to newer versions of BioNumerics using the TRST-Tandem Repeat Sequence Analysis plugin which will identify dr and dt sequences directly from .ab1 files.  For more information regarding use of BioNumerics and the TRST plugin for automated dru type analysis email info “at” dru-typing.org.

 

ADDITIONAL SELECTED REFERENCES:

 

Butin, M., J. P. Rasigade, P. Martins-Simoes, H. Meugnier, H. Lemriss, R. V. Goering, A. Kearns, M. A. Deighton, O. Denis, A. Ibrahimi, O. Claris, F. Vandenesch, J. C. Picaud, and F. Laurent. 2015. Wide geographical dissemination of the multiresistant Staphylococcus capitis NRCS-A clone in neonatal intensive-care units. Clin.Microbiol.Infect. (in press)

McManus, B. A., D. C. Coleman, E. C. Deasy, G. I. Brennan, B. O’ Connell, S. Monecke, R. Ehricht, B. Leggett, N. Leonard, and A. C. Shore. 2015. Comparative Genotypes, Staphylococcal Cassette Chromosome mec (SCCmec) Genes and Antimicrobial Resistance amongst Staphylococcus epidermidis and Staphylococcus haemolyticus Isolates from Infections in Humans and Companion Animals. PLoS.One. 10:e0138079.

Kadlec, K., S. Schwarz, R. V. Goering, and J. S. Weese. 2015. Direct repeat unit (dru) typing of methicillin-resistant Staphylococcus pseudintermedius from dogs and cats. J.Clin.Microbiol. doi: 10.1128/JCM.01850-15                                    

Monecke, S., G. W. Coombs, J. Pearson, H. Hotzel, P. Slickers, and R. Ehricht. 2015. A Clonal Complex 12 Methicillin-Resistant Staphylococcus aureus Strain, West Australian MRSA-59, Harbors a Novel Pseudo-SCCmec Element. Antimicrob.Agents Chemother. 59:7142-7144.

Li, D., C. Wu, Y. Wang, R. Fan, S. Schwarz, and S. Zhang. 2015. Identification of multiresistance gene cfr in methicillin-resistant Staphylococcus aureus from pigs: plasmid location and integration into a staphylococcal cassette chromosome mec complex. Antimicrob.Agents Chemother. 59:3641-3644.

Siak, M., A. K. Burrows, G. W. Coombs, M. Khazandi, S. Abraham, J. M. Norris, J. S. Weese, and D. J. Trott. 2014. Characterization of meticillin-resistant and meticillin-susceptible isolates of Staphylococcus pseudintermedius from cases of canine pyoderma in Australia. J.Med.Microbiol. 63:1228-1233.

Wendlandt, S., K. Kadlec, A. T. Fessler, D. E. van, and S. Schwarz. 2014. Two different erm(C)-carrying plasmids in the same methicillin-resistant Staphylococcus aureus CC398 isolate from a broiler farm. Vet.Microbiol. doi:S0378-1135(14)00031-5

Scharn, C.R., F.C. Tenover, and R.V. Goering. 2013. Transduction of staphylococcal Cassette Chromosome mec elements between strains of Staphylococcus aureus. Antimicrob. Agents Chemother.  57:5233-5238.

Wendlandt, S., K. Kadlec, A. T. Fessler, D. Mevius, A. van Essen-Zandbergen, P. D. Hengeveld, T. Bosch, L. Schouls, S. Schwarz, and D. E. van. 2013. Transmission of methicillin-resistant Staphylococcus aureus isolates on broiler farms. Vet.Microbiol. 167:632-637.

Couto N., A. Belas, P. Tilley, I. Couto, L.T. Gama, K. Kadlec, S. Schwarz, and C. Pomba.  2013.  Biocide and antimicrobial susceptibility of methicillin-resistant staphylococcal isolates from horses. Vet Microbiol. 166:299-303.

Weiss S., K. Kadlec, A.T. Fessler, and S. Schwarz.  2013.  Identification and characterization of methicillin-resistant Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus and Staphylococcus pettenkoferi from a small animal clinic. Vet. Microbiol. 167:680-685.

Perreten, V., P. Chanchaithong, N. Prapasarakul, A. Rossano, S. Blum, D. Elad, and S. Schwendener.  2013. Novel pseudo SCCmec element  ({Psi}SCCmec57395) in methicillin-resistant Staphylococcus pseudintermedius CC179. Antimicrob. Agents Chemother. 57:5509-5515.

Wendlandt, S., K. Kadlec, A. T. Fessler, S. Monecke, R. Ehricht, A. W. van de Giessen, P. D. Hengeveld, X. Huijsdens, S. Schwarz, and D. E. van. 2013. Resistance phenotypes and genotypes of methicillin-resistant Staphylococcus aureus isolates from broiler chickens at slaughter and abattoir workers. J.Antimicrob.Chemother. 68:2458-2463.

El-Mahdy, T. S., M. El-Ahmady, and R. V. Goering. 2013. Molecular characterization of methicillin-resistant Staphylococcus aureus isolated over a 2-year period in a Qatari hospital from multinational patients. Clin.Microbiol.Infect. 20:169-173.

Wan, M.T., T.L. Lauderdale, N. Kobayashi, N. Urushibara, and C.C. Chou.  2013.  Population deviation of piggery-associated methicillin-resistant Staphylococcus aureus based on mec-associated direct repeat analysis.  Infect. Genet. Evol. 16:349-354.

Bartels, M.D., K. Boye, D.C. Oliveria, P. Worning, R.V. Goering, and H. Westh.  2013. Associations between dru types and SCCmec cassettes.  PLoS One. 8(4):e61860. doi: 10.1371/journal.pone.0061860.

Fossum Moen, A.E., T.M. Tannaes, and T.M. Leegaard.  2013. USA300 methicillin-resistant Staphylococcus aureus in Norway.  APMIS. 121:1091-1096

Himsworth C.G., D.M. Patrick, K. Parsons, A. Feng, and J.S. Weese. 2013. Methicillin-resistant Staphylococcus pseudintermedius in rats. Emerg.Infect.Dis. 19:169-170.

Kinnevey, P.M., A.C. Shore, G.I. Brennan, D.J. Sullivan, R. Ehricht, S. Monecke, P. Slickers, and D.C. Coleman. 2013. Emergence of seuqence type 779 methicillin-resistant Staphylococcus aureus harboring a novel pseudo Staphylococcal Cassette Chromosome mec (SCCmec)-SCC-SCCcrispr composite element in Irish hospitals. Antimicrob. Agents Chemother. 57:524-531.

Monecke, S., A. Ruppelt, S. Wendlandt, S. Schwarz, P. Slickers, R. Ehricht, and S. C. Jackel. 2013. Genotyping of Staphylococcus aureus isolates from diseased poultry. Vet.Microbiol. 162:806-812.

Weese, J. S., K. Sweetman, H. Edson, and J. Rousseau. 2013. Evaluation of minocycline susceptibility of methicillin-resistant Staphylococcus pseudintermedius. Vet.Microbiol. 162:968-971.

Coombs, G. W., R. V. Goering, K. Y. Chua, S. Monecke, B. P. Howden, T. P. Stinear, R. Ehricht, F. G. O’Brien, and K. J. Christiansen. 2012. The molecular epidemiology of the highly virulent ST93 Australian community Staphylococcus aureus strain. PLoS.One. 7:e43037. doi:10.1371/journal.pone.0043037.

Creamer, E., A. C. Shore, A. S. Rossney, A. Dolan, O. Sherlock, D. Fitzgerald-Hughes, D. J. Sullivan, P. M. Kinnevey, P. O’Lorcain, R. Cunney, D. C. Coleman, and H. Humphreys. 2012. Transmission of endemic ST22-MRSA-IV on four acute hospital wards investigated using a combination of spa, dru and pulsed-field gel electrophoresis typing. Eur.J.Clin.Microbiol.Infect.Dis. 31:3151-3161.

Dhanoa, A., V. A. Singh, A. Mansor, M. Y. Yusof, K. T. Lim, and K. L. Thong. 2012. Acute haematogenous community-acquired methicillin-resistant Staphylococcus aureus osteomyelitis in an adult: Case report and review of literature. BMC.Infect.Dis. 12:270. doi:1471-2334-12-270 [pii];10.1186/1471-2334-12-270 [doi].

Julian, T. A. Singh, J. Rousseau, and J. S. Weese.  2012. Methicillin-resistant staphylococcal contamination of cellular phones of personnel in veterinary teaching hospital.  BMC Res.Notes. 5: 193. doi:10.1186/1756-0500-5-193

Lim, K. T., Y. A. Hanifah, M. Y. Yusof, R. V. Goering, and K. L. Thong. 2012. Temporal changes in the genotypes of methicillin-resistant Staphylococcus aureus strains isolated from a tertiary Malaysian hospital based on MLST, spa, and mec-associated dru typing. Diagn.Microbiol.Infect.Dis. 74:106-112.

Manoharan, A., L. Zhang, A. Poojary, L. Bhandarkar, G. Koppikar, and D. A. Robinson. 2012. An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications. Epidemiol.Infect. 140:1809-1812.

Wang, S.-H., K. Yosef, L. Hines, J.R. Mediavilla, L. Zhang, L. Chen, A. Hoet, T. Bannerman, P. Pancholi, D. Ashley Robinson, B.N. Kreiswirth, and K.B. Stevenson. 2012. Methicillin-resistant Staphylococcus aureus type 239-III, Ohio, USA, 2007-2009. Emerg.Infect.Dis. 18:1557-1565.

Ghaznavi-Rad, E., R. V. Goering, S. M. Nor, P. L. Weng, Z. Sekawi, M. Tavakol, B. A. van, and V. Neela. 2011. mec-associated dru typing in the epidemiological analysis of ST239 MRSA in Malaysia. Eur.J.Clin.Microbiol.Infect.Dis. 30:1365-1369.

Smyth, D. S., A. Wong, and D. A. Robinson. 2011. Cross-species spread of SCCmec IV subtypes in staphylococci. Infect.Genet.Evol. 11:446-453.

Fessler, A., C. Scott, K. Kadlec, R. Ehricht, S. Monecke, and S. Schwarz. 2010. Characterization of methicillin-resistant Staphylococcus aureus ST398 from cases of bovine mastitis. J.Antimicrob.Chemother. 65:619-625.

Ionescu, R., J. R. Mediavilla, L. Chen, D. O. Grigorescu, M. Idomir, B. N. Kreiswirth, and R. B. Roberts. 2010. Molecular characterization and antibiotic susceptibility of Staphylococcus aureus from a multidisciplinary hospital in Romania. Microb.Drug Resist. 16:263-272.

Shore, A. C., A. S. Rossney, P. M. Kinnevey, O. M. Brennan, E. Creamer, O. Sherlock, A. Dolan, R. Cunney, D. J. Sullivan, R. V. Goering, H. Humphreys, and D. C. Coleman. 2010. Enhanced discrimination of highly clonal ST22-methicillin-resistant Staphylococcus aureus IV isolates achieved by combining spa, dru, and pulsed-field gel electrophoresis typing data. J.Clin.Microbiol. 48:1839-1852.

Smyth, D. S., L. K. McDougal, F. W. Gran, A. Manoharan, M. C. Enright, J. H. Song, L. H. de, and D. A. Robinson. 2010. Population structure of a hybrid clonal group of methicillin-resistant Staphylococcus aureus, ST239-MRSA-III. PLoS.One. 5:e8582. doi:10.1371/journal.pone.0008582 [doi].