Welcome

May 24th, 2013

          WELCOME TO THE DRU TYPING WEB PAGE

          As of 24 May, 2013 the dru database contains 92 dru repeats
          and 435 dru types with from 1 to 23 repeats

         

          Click here to go to the search page.

 

 

 

 

BACKGROUND:

Variable-number tandem repeat (VNTR) sequences have found important use in the epidemiological typing of problem bacterial pathogens. In methicillin-resistant Staphylococcus aureus (MRSA), the direct-repeat unit (dru) VNTR region adjacent to IS431 in SCCmec has proved useful in the epidemiological analysis of highly uniform epidemic strains (e.g., EMRSA15 and -16) and in tracking the horizontal movement of SCCmec.  Efficient use of dru typing has been facilitated by a uniform system of nomenclature.  However, optimum use of this typing approach requires a convenient means where newly generated data can be cataloged and compared in an internationally shared database.

Publication of the typing approach and nomenclature can be found at:

Goering, R. V., D. Morrison, Z. Al-Doori, G. F. Edwards, and C. G. Gemmell. 2008. Usefulness of mec-associated direct repeat unit (dru) typing in the epidemiological analysis of highly clonal methicillin-resistant Staphylococcus aureus in Scotland. Clin.Microbiol.Infect. 14:964-969.

PCR conditions:

forward primer 5’ GTTAGCATATTACCTCTCCTTGC 3’
reverse primer 5’ GCCGATTGTGCTTGATGAG 3’

Initial denaturation step at 94°C for 2 min followed by 30 cycles of 94°C for 1 min, 52°C for 1 min, and 72°C for 1 min.

 

QUERYING THE DATABASE:

The search page of the dru-typing.org website allows investigators to enter user generated 40-bp repeat sequences which are then searched against the current database of dru repeats (dr) and identified, if known.  Specific combinations of repeats separated by dashes (e.g., 5a-2d-3b-4e) may also be queried against the database and, if recognized, the resulting dru type (dt) will be identified.

Click here to go to the search page.

 

ADDITION OF NEW ENTRIES TO THE DATABASE:

New dru repeat and/or dru type chromatograms can be submitted online for verification and inclusion into the database. Investigators with potentially new dru-repeats (dr) or dru-types (dt) should submit their trace files (.ab1) of both forward and reverse sequences by email to:  info “at” dru-typing.org. Upon verification, the new entries will be added to the existing database.

Questions regarding the submission of new dru-repeat or dru-type sequences or other questions, comments, or suggestions may be emailed to: info “at” dru-typing.org  You can click here to download text files containing the latest dru types and dru repeats.

 

AUTOMATED DRU TYPING:

Working with dru repeat sequences manually can be a challenge. This can be dramatically simplified for those laboratories having access to newer versions of BioNumerics using their newly developed TRST-Tandem Repeat Sequence Analysis plugin which will identify dr and dt sequences directly from .ab1 files (email info “at” dru-typing.org for more information).

For laboratories that do not have BioNumerics, Davida Smyth and Mal McKay, formerly of D. Ashley Robinson’s laboratory, have performed a service to the scientific community by creating a stand-alone dru typing tool which is freely available. The application requires Adobe Air to be installed on your computer. If you click on the link below, Adobe Air and then DruID will be downloaded and installed.

www.mystrains.com/druid

DruID will recognize the sequence of known dru repeats (dr’s) in a plain text file (e.g., prepared in FASTA format). The text can be either upper or lowercase but the key is to search the sequence to insure the presence of the signature 5’ flanking sequence (TCTTACTGAGATTATACTA) preceding the first repeat and the 3’ flanking sequence (ATAAGGGGTACAGAAAAAC) following the last full repeat.

The program’s help file gives good instruction, but essentially what one does is to “drag” sequence text files into the “file” region of the program window and the result will appear in the upper window.

DruID is loaded with dr and dt sequences, however, if the program indicates an unknown dt check it on the dru server to see if it has been newly added to the database. If not, send the appropriate sequence (.ab1 file) to info “at” dru-typing.org for verification.

As needed, the program’s internal dr/dt database will be updated which can simply be re-downloaded.

 

ADDITIONAL SELECTED REFERENCES:

1.  Wan, M.T., T.L. Lauderdale, N. Kobayashi, N. Urushibara, and C.C. Chou.  2013.  Population deviation of piggery-associated methicillin-resistant Staphylococcus aureus based on mec-associated direct repeat analysis.  Infect. Genet. Evol. 16:349-354.

2.   Bartels, M.D., K. Boye, D.C. Oliveria, P. Worning, R.V. Goering, and H. Westh.  2013. Associations between dru Types and SCCmec Cassettes.  PLoS One. 8(4):e61860. doi: 10.1371/journal.pone.0061860.

3.   Fossum Moen, A.E., T.M. Tannaes, and T.M. Leegaard.  2013. USA300 Methicillin-resistant Staphylococcus aureus in Norway.  APMIS. doi: 10.1111/apm.12077. [Epub ahead of print]

4.   Himsworth C.G., D.M. Patrick, K. Parsons, A. Feng, and J.S. Weese. 2013. Methicillin-resistant Staphylococcus pseudintermedius in rats. Emerg.Infect.Dis. 19:169-170.

5.   Kinnevey, P.M., A.C. Shore, G.I. Brennan, D.J. Sullivan, R. Ehricht, S. Monecke, P. Slickers, and D.C. Coleman. 2013. Emergence of Seuqence Type 779 Methicillin-Resistant Staphylococcus aureus Harboring a Novel Pseudo Staphylococcal Cassette Chromosome mec (SCCmec)-SCC-SCCcrispr Composite Element in Irish Hospitals. Antimicrob. Agents Chemother. 57:524-531.

6.   Monecke, S., A. Ruppelt, S. Wendlandt, S. Schwarz, P. Slickers, R. Ehricht, and S. C. Jackel. 2013. Genotyping of Staphylococcus aureus isolates from diseased poultry. Vet.Microbiol. 162:806-812.

7.   Weese, J. S., K. Sweetman, H. Edson, and J. Rousseau. 2013. Evaluation of minocycline susceptibility of methicillin-resistant Staphylococcus pseudintermedius. Vet.Microbiol. 162:968-971.

8.   Coombs, G. W., R. V. Goering, K. Y. Chua, S. Monecke, B. P. Howden, T. P. Stinear, R. Ehricht, F. G. O’Brien, and K. J. Christiansen. 2012. The molecular epidemiology of the highly virulent ST93 Australian community Staphylococcus aureus strain. PLoS.One. 7:e43037. doi:10.1371/journal.pone.0043037.

9.   Creamer, E., A. C. Shore, A. S. Rossney, A. Dolan, O. Sherlock, D. Fitzgerald-Hughes, D. J. Sullivan, P. M. Kinnevey, P. O’Lorcain, R. Cunney, D. C. Coleman, and H. Humphreys. 2012. Transmission of endemic ST22-MRSA-IV on four acute hospital wards investigated using a combination of spa, dru and pulsed-field gel electrophoresis typing. Eur.J.Clin.Microbiol.Infect.Dis. 31:3151-3161.

10.   Dhanoa, A., V. A. Singh, A. Mansor, M. Y. Yusof, K. T. Lim, and K. L. Thong. 2012. Acute haematogenous community-acquired methicillin-resistant Staphylococcus aureus osteomyelitis in an adult: Case report and review of literature. BMC.Infect.Dis. 12:270. doi:1471-2334-12-270 [pii];10.1186/1471-2334-12-270 [doi].

11.  Julian, T. A. Singh, J. Rousseau, and J. S. Weese.  2012. Methicillin-resistant staphylococcal contamination of cellular phones of personnel in veterinary teaching hospital.  BMC Res.Notes. 5: 193. doi:10.1186/1756-0500-5-193

12.   Lim, K. T., Y. A. Hanifah, M. Y. Yusof, R. V. Goering, and K. L. Thong. 2012. Temporal changes in the genotypes of methicillin-resistant Staphylococcus aureus strains isolated from a tertiary Malaysian hospital based on MLST, spa, and mec-associated dru typing. Diagn.Microbiol.Infect.Dis. 74:106-112.

13.   Manoharan, A., L. Zhang, A. Poojary, L. Bhandarkar, G. Koppikar, and D. A. Robinson. 2012. An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications. Epidemiol.Infect. 140:1809-1812.

14.   Wang, S.-H., K. Yosef, L. Hines, J.R. Mediavilla, L. Zhang, L. Chen, A. Hoet, T. Bannerman, P. Pancholi, D. Ashley Robinson, B.N. Kreiswirth, and K.B. Stevenson. 2012. Methicillin-resistant Staphylococcus aureus type 239-III, Ohio, USA, 2007-2009. Emerg.Infect.Dis. 18:1557-1565.

15.   Ghaznavi-Rad, E., R. V. Goering, S. M. Nor, P. L. Weng, Z. Sekawi, M. Tavakol, B. A. van, and V. Neela. 2011. mec-associated dru typing in the epidemiological analysis of ST239 MRSA in Malaysia. Eur.J.Clin.Microbiol.Infect.Dis. 30:1365-1369.

16.   Smyth, D. S., A. Wong, and D. A. Robinson. 2011. Cross-species spread of SCCmec IV subtypes in staphylococci. Infect.Genet.Evol. 11:446-453.

17.   Fessler, A., C. Scott, K. Kadlec, R. Ehricht, S. Monecke, and S. Schwarz. 2010. Characterization of methicillin-resistant Staphylococcus aureus ST398 from cases of bovine mastitis. J.Antimicrob.Chemother. 65:619-625.

18.   Ionescu, R., J. R. Mediavilla, L. Chen, D. O. Grigorescu, M. Idomir, B. N. Kreiswirth, and R. B. Roberts. 2010. Molecular characterization and antibiotic susceptibility of Staphylococcus aureus from a multidisciplinary hospital in Romania. Microb.Drug Resist. 16:263-272.

19.   Shore, A. C., A. S. Rossney, P. M. Kinnevey, O. M. Brennan, E. Creamer, O. Sherlock, A. Dolan, R. Cunney, D. J. Sullivan, R. V. Goering, H. Humphreys, and D. C. Coleman. 2010. Enhanced discrimination of highly clonal ST22-methicillin-resistant Staphylococcus aureus IV isolates achieved by combining spa, dru, and pulsed-field gel electrophoresis typing data. J.Clin.Microbiol. 48:1839-1852.

20.   Smyth, D. S., L. K. McDougal, F. W. Gran, A. Manoharan, M. C. Enright, J. H. Song, L. H. de, and D. A. Robinson. 2010. Population structure of a hybrid clonal group of methicillin-resistant Staphylococcus aureus, ST239-MRSA-III. PLoS.One. 5:e8582. doi:10.1371/journal.pone.0008582 [doi].